GEO Profile Links for Gene (Select 56747) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2258

<< First< Prev

Page of 113

Next >Last >>

Select item 756813801.

Sez6l - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6481, 104480671 (ID_REF), GDS4002, XM_132255, Sez6l (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75681380

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971436932.

Sez6l - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL9734, 100112379_TGI_at (ID_REF), GDS4495, NM_019982

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97143693

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 285175913.

Sez6l - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL2987, 4891 (ID_REF), GDS2227, AF220355

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28517591

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619132704.

Sez6l - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS3598, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61913270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1304329015.

Sez6l - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P201747 (ID_REF), GDS5666, NM_001253916, A_51_P201747 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130432901

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1276144506.

Sez6l - Progranulin deficiency effect on various brain regions: time course

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2805839 (ID_REF), GDS5501, NM_019982

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127614450

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74995147.

Sez6l - MPSS transcriptome analysis project

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1010, GATCACAGCCTGAGCCTTTG (ID_REF), GDS868, BC056471

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7499514

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1254820708.

Sez6l - Embryonic lung and brain cortex: endothelial cells

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS5417, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 125482070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1215699709.

Sez6l - Antidepressant fluoxetine effect on depression model: dorsal dentate gyrus

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS5307, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121569970

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11594649010.

Sez6l - Auditory fear conditioning effect on amygdala: time course

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2805839 (ID_REF), GDS5157, NM_019982, SEZ6L (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115946490

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7936574011.

Sez6l - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6246, 10532542 (ID_REF), GDS4115, NM_001253916, NM_001253917, NM_019982, AB206790, BC065117, BC065129, BC099839, DQ167195, chr5:112419151-112577185 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79365740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7193475012.

Sez6l - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2805839 (ID_REF), GDS3900, NM_019982

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71934750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4397567013.

Sez6l - Various brain regions of several inbred strains

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS2917, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43975670

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3056607014.

Sez6l - Bed nucleus of the stria terminalis, nucleus accumbens, and dorsal striatum comparison

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS2344, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 30566070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7659607015.

Sez6l - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS4034, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76596070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6162879016.

Sez6l - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2805839 (ID_REF), GDS3582, NM_019982, SEZ6L (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61628790

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5055327017.

Sez6l - Transcription factor Ctip2 deficiency effect on brain striata

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1424764_at (ID_REF), GDS3178, 56747 (Gene ID), AF220355

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 50553270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1467044018.

Sez6l - Transcription factor Tcf1 knockout effect on pancreatic islets (MG-U74A)

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL81, 103543_at (ID_REF), GDS1473, 56747 (Gene ID), AW208098

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14670440

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 664364019.

Sez6l - Amyloid precursor protein mutant overexpression in strain resistant to neuronal cell loss

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL81, 103543_at (ID_REF), GDS811, 56747 (Gene ID), AW208098

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 6643640

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11430113420.

Sez6l - Glucose effect on young pancreatic islets: dose response and time course

Annotation:: Sez6l, seizure related 6 homolog like

Organism:: Mus musculus

Reporter:: GPL1261, 1440128_s_at (ID_REF), GDS4942, 56747 (Gene ID), AW539724

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 114301134

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 113

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 56747) (2258)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2258

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity