GEO Profile Links for Gene (Select 271639) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 943

<< First< Prev

Page of 48

Next >Last >>

Select item 129901051.

Adcy10 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL891, 6205 (ID_REF), GDS1359, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12990105

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162918542.

Adcy10 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2672960 (ID_REF), GDS5172, NM_173029, ADCY10 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116291854

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940171193.

Adcy10 - Gonadal development: ovaries and testes

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS4503, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94017119

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 314526194.

Adcy10 - Male germ cells

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS2390, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31452619

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 176916055.

Adcy10 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL891, 6205 (ID_REF), GDS1675, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17691605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123163196.

Adcy10 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS5091, 271639 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112316319

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 424458197.

Adcy10 - Taf7l deficiency effect on the testis

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS2857, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42445819

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130134058.

Adcy10 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL891, 6205 (ID_REF), GDS1360, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13013405

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1327166549.

Adcy10 - Diet-induced obesity model: white adipose tissue

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2672960 (ID_REF), GDS6247, NM_173029, ADCY10 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132716654

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13224995410.

Adcy10 - High-fat diet effect on brown adipose tissue development

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2672960 (ID_REF), GDS6000, NM_173029, ADCY10 (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132249954

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7218961911.

Adcy10 - Polyubiquitin knockout effect on testis: time course

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS3906, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72189619

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5536241212.

Adcy10 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL5759, NM_173029_at (ID_REF), GDS3385, NM_173029

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55362412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6192811913.

Adcy10 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS3598, 271639 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61928119

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 632880514.

Adcy10 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL891, 6205 (ID_REF), GDS775, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6328805

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752868615.

Adcy10 - MPSS transcriptome analysis project

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1010, GATCAATGGCTTCAGACAGT (ID_REF), GDS868, NM_173029

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7528686

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 5542291916.

Adcy10 - Chromatin remodeling component BAF250a deficiency effect on embryonic stem cells in vitro

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1439613_at (ID_REF), GDS3387, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 55422919

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4143876917.

Adcy10 - Nephronophthisis model

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL2897, 409073 (ID_REF), GDS2817, NM_173029

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41438769

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7505282018.

Adcy10 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P256747 (ID_REF), GDS3986, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75052820

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3754349119.

Adcy10 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL340, 1439613_at (ID_REF), GDS2669, 271639 (Gene ID)

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37543491

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 13162862020.

Adcy10 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Adcy10, adenylate cyclase 10

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P256747 (ID_REF), GDS5818, NM_173029, A_51_P256747 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131628620

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 48

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 271639) (943)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 943

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity