GEO Profiles Links for Nucleotide (Select 30354397) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 155

<< First< Prev

Page of 8

Next >Last >>

Select item 1182911371.

Prcc - Adam10 deficiency effect on the epidermis

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5229, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118291137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75268202.

Prcc - MPSS transcriptome analysis project

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL1010, GATCTACGGCCTTGGTTGGG (ID_REF), GDS868, BC052072

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7526820

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1101078373.

Prcc - Induced myeloproliferative neoplasm effect on Scl-tTA::TRE-BCR/ABL double-transgenic model of chronic myeloid leukemia: osteoblastic lineage cells

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5024, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 110107837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755555374.

Prcc - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS3999, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75555537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751047375.

Prcc - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS3987, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75104737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268269376.

Prcc - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5456, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126826937

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1000594377.

Prcc - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4588, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100059437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1320265378.

Prcc - Nebulin deficiency effect on the quadriceps

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5880, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132026537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064355379.

Prcc - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4886, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106435537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10313553710.

Prcc - H3K4me3 histone demethylase Fbxl10 overexpression effect on fibroblast cell line

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4788, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 103135537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8749943711.

Prcc - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4317, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87499437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7936223712.

Prcc - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4115, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79362237

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683563713.

Prcc - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4486, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96835637

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9419563714.

Prcc - Endoplasmic reticulum thiol oxidase deficiency effect on embryonic fibroblasts

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4507, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 94195637

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11436303715.

Prcc - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4946, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114363037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11073643716.

Prcc - High Mobility Group AT-hook Protein 2 deficiency effect on the embryonic lung

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5048, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 110736437

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6665183717.

Prcc - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS3748, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66651837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8376993718.

Prcc - Pancreatic CD45+ immune cells from NOD model of type 1 diabetes

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4347, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 83769937

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12436983719.

Prcc - Transforming growth factor β effect on mammary epithelial NMuMG cells overexpressing major satellite transcripts

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS5387, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124369837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10870203720.

Prcc - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Prcc, papillary renal cell carcinoma (translocation-associated)

Organism:: Mus musculus

Reporter:: GPL6246, 10499265 (ID_REF), GDS4973, NM_033573, AF273750, BC027831, BC052072, BC082784, chr3:87858595-87885580 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108702037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 30354397) (155)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 155

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity