GEO Profile Links for Gene (Select 225362) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1296

<< First< Prev

Page of 65

Next >Last >>

Select item 1158057921.

Reep2 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1424386_at (ID_REF), GDS5114, 225362 (Gene ID), BC020184

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115805792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922852922.

Reep2 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1424386_at (ID_REF), GDS4432, 225362 (Gene ID), BC020184

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92285292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 258635843.

Reep2 - Developing mammary gland: terminal end buds and ducts

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL2660, 12584 (ID_REF), GDS2115, BC020184

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25863584

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 650492124.

Reep2 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL2995, 407138 (ID_REF), GDS3692, NM_144865

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65049212

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1304495165.

Reep2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P125467 (ID_REF), GDS5666, NM_144865, A_52_P125467 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130449516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1125116186.

Reep2 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL4783, M200005010 (ID_REF), GDS2645, NM_144865, BC020184

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112511618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1122080927.

Reep2 - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL1261, 1424386_at (ID_REF), GDS5089, 225362 (Gene ID), BC020184

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112208092

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 984851058.

Reep2 - Pulmonary vascular microendothelial cell response to mutations in type 2 receptor for the bone morphogenetic protein signaling pathway, BMPR2

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4543, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 98485105

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129897199.

Reep2 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL891, 5819 (ID_REF), GDS1359, NM_144865, A_51_P391634 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12989719

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751679210.

Reep2 - MPSS transcriptome analysis project

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTTTTACACATTCAT (ID_REF), GDS868, NM_144865

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7516792

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2967056911.

Reep2 - Atherogenic diet effect on the liver: time course

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB181521 (ID_REF), GDS2292, BC020184

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29670569

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10391220512.

Reep2 - H6 family homoebox 1 deficiency effect on the retina

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4810, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 103912205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9713164613.

Reep2 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL9734, 100113531_TGI_at (ID_REF), GDS4495, NM_144865

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97131646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10676720514.

Reep2 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4898, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106767205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683090515.

Reep2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4486, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96830905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8087340516.

Reep2 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4155, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 80873405

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3273974317.

Reep2 - Prostate cancer progression model: stromal cell

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL4371, 16343 (ID_REF), GDS2443, NM_144865

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32739743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 984758118.

Reep2 - Corticospinal motor neuron development

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL339, 1424386_at (ID_REF), GDS1076, 225362 (Gene ID), BC020184

DataSet type:: Expression profiling by array, transformed count, 19 samples

ID:: 9847581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12909500519.

Reep2 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS5628, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129095005

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10505860520.

Reep2 - Transcription factor treatment effect on embryonic fibroblasts

Annotation:: Reep2, receptor accessory protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10454771 (ID_REF), GDS4835, NM_001204914, NM_144865, AY562230, BC020184, EU555417, chr18:34840658-34847455 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 28 samples

ID:: 105058605

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 65

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 225362) (1296)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1296

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity