GEO Profile Links for Gene (Select 20892) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1640

<< First< Prev

Page of 82

Next >Last >>

Select item 455848921.

Stra13 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL4636, 2792 (ID_REF), GDS2976, NM_016665

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45584892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569381842.

Stra13 - Vancomycin effect on the kidney: dose response

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS3435, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56938184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201639843.

Stra13 - Age effect on hematopoietic stem cells

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS1803, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20163984

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 86887114.

Stra13 - Bile ductular differentiation of embryonic hepatoblasts: time course

Annotation:: Stra13, Stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1205, 15784 (ID_REF), GDS970, AI666615

DataSet type:: Expression profiling by array, log ratio, 24 samples

ID:: 8688711

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 86796605.

Stra13 - Bile ductular differentiation of embryonic hepatoblasts: time course

Annotation:: Stra13, Stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1205, 6078 (ID_REF), GDS970, AA244657

DataSet type:: Expression profiling by array, log ratio, 24 samples

ID:: 8679660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1225947496.

Stra13 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1237761 (ID_REF), GDS5341, NM_016665

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122594749

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 663379847.

Stra13 - Transcription factor SRF deletion effect on hematopoietic stem cells

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS3732, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 66337984

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 156402638.

Stra13 - Embryonic fibroblast response to adenoviral vector infection (Mu11K-B)

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL76, u95003_s_at (ID_REF), GDS1529, U95003

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 15640263

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74693809.

Stra13 - MPSS transcriptome analysis project

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGCAGCTGTTACCT (ID_REF), GDS868, NM_016665

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7469380

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11435162610.

Stra13 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL6246, 10393917 (ID_REF), GDS4946, NM_016665, XM_006532729, BC052335, U95003, U95005, U95004, AK076181, chr11:120710942-120713743 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114351626

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7563762711.

Stra13 - High and Low Anxiety: multiple brain regions

Annotation:: Stra13, Stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL7467, 4162 (ID_REF), GDS4001, AI666615

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75637627

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1840044712.

Stra13 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli (dye swap)

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1226, 9547 (ID_REF), GDS1706, U95005

DataSet type:: Expression profiling by array, log2 ratio, 15 samples

ID:: 18400447

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11853268413.

Stra13 - Lamin A exon 9 deletion effect on fibroblasts

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS5235, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118532684

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4859908414.

Stra13 - Liver response to a high cholesterol diet and phenobarbital

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL339, 1416553_at (ID_REF), GDS3103, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 48599084

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1506508415.

Stra13 - Mechanical stress effect on fibroblasts from various fetal tissues (MG-430A)

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL339, 1416553_at (ID_REF), GDS1500, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 15065084

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 616486316.

Stra13 - CD8 T cell development (Mu11K-B)

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL76, u95003_s_at (ID_REF), GDS755, U95003

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 6164863

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5075917.

Stra13 - Type 1 diabetes gene expression profiling

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL24, 23759 (ID_REF), GDS10, U95003

DataSet type:: Expression profiling by array, count, 28 samples

ID:: 50759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13116898418.

Stra13 - FLT3/ITD-SmoM2 acute myeloid leukemia model: sorted bone marrow cells

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS5806, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131168984

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12715058419.

Stra13 - UTX deficiency effect on embryonic stem cells

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS5465, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 127150584

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12315968420.

Stra13 - RAW264.7 macrophage cell line response to murine norovirus infection

Annotation:: Stra13, stimulated by retinoic acid 13

Organism:: Mus musculus

Reporter:: GPL1261, 1416553_at (ID_REF), GDS5356, 20892 (Gene ID), NM_016665

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 123159684

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 82

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 20892) (1640)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1640

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity