ClinVar Genomic variation as it relates to human health
NM_001036.6(RYR3):c.14142+6AGCCCACCCACTGCGGGGCC[3]
Germline
Classification
(1)
Likely benign
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
AVEN | - | - |
GRCh38 GRCh37 |
17 | 209 | |
RYR3 | - | - |
GRCh38 GRCh37 |
1465 | 1625 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Likely benign (1) |
|
Oct 6, 2020 | RCV001485727.6 |
Citations for germline classification of this variant
HelpText-mined citations for rs139758855 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Feb 14, 2024