ClinVar Genomic variation as it relates to human health
NM_017777.4(MKS1):c.1408-34_1408-6del
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_017777.4(MKS1):c.1408-34_1408-6del
Variation ID: 188400 Accession: VCV000188400.55
- Type and length
-
Deletion, 29 bp
- Location
-
Cytogenetic: 17q22 17: 58206553-58206581 (GRCh38) [ NCBI UCSC ] 17: 56283914-56283942 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jul 24, 2013 May 12, 2024 Mar 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_017777.4:c.1408-34_1408-6del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
intron variant NM_001321268.2:c.799-34_799-6del intron variant NM_001321269.2:c.1408-201_1408-173del intron variant NM_001330397.2:c.1274-201_1274-173del intron variant NM_017777.3:c.1408-34_1408-6del29 NM_017777.3:c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC NC_000017.11:g.58206555_58206583del NC_000017.10:g.56283916_56283944del NG_013020.1:g.18828_18856del NG_013032.1:g.18025_18053del LRG_687:g.18025_18053del LRG_687t1:c.1408-34_1408-6del - Protein change
- Other names
- -
- Canonical SPDI
- NC_000017.11:58206552:GCATGCCATTGGGACAGCCTCAGGTTTCTGC:GC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Comment on variant
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MKS1 | - | - |
GRCh38 GRCh37 |
938 | 1014 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Jan 24, 2024 | RCV000168467.11 | |
Pathogenic (6) |
criteria provided, multiple submitters, no conflicts
|
Feb 20, 2023 | RCV000210823.11 | |
Pathogenic (1) |
criteria provided, single submitter
|
Jun 19, 2016 | RCV000491550.3 | |
Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Mar 1, 2024 | RCV000273342.34 | |
Pathogenic (2) |
criteria provided, single submitter
|
Apr 8, 2018 | RCV000984005.4 | |
Pathogenic (1) |
criteria provided, single submitter
|
Jan 26, 2022 | RCV002515190.4 | |
Pathogenic (1) |
criteria provided, single submitter
|
Oct 31, 2023 | RCV003474892.1 | |
Pathogenic (1) |
criteria provided, single submitter
|
Feb 9, 2024 | RCV004528921.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(-)
|
criteria provided, single submitter
Method: not provided
|
Meckel syndrome, type 1
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Institute of Human Genetics, University Hospital of Duesseldorf
Accession: SCV004171177.1
First in ClinVar: Dec 02, 2023 Last updated: Dec 02, 2023 |
|
|
Pathogenic
(Oct 31, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Bardet-Biedl syndrome 13
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004194914.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(Jun 19, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Familial aplasia of the vermis
Affected status: yes
Allele origin:
maternal
|
Universitätsklinikum Salzburg, Universitätskinderklinik
Accession: SCV000282232.1
First in ClinVar: Jun 25, 2017 Last updated: Jun 25, 2017 |
Number of individuals with the variant: 1
Sex: male
|
|
Pathogenic
(Apr 11, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000700971.2
First in ClinVar: Dec 26, 2017 Last updated: Jul 31, 2019 |
Number of individuals with the variant: 5
Sex: mixed
|
|
Pathogenic
(Dec 24, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Meckel syndrome, type 1
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV001194240.1
First in ClinVar: Apr 06, 2020 Last updated: Apr 06, 2020 |
Comment:
NM_017777.3(MKS1):c.1408-34_1408-6del29 is classified as pathogenic in the context of MKS1-related disorders. Sources cited for classification include the following: PMID 16415886 and 23351400. Classification of NM_017777.3(MKS1):c.1408-34_1408-6del29 … (more)
NM_017777.3(MKS1):c.1408-34_1408-6del29 is classified as pathogenic in the context of MKS1-related disorders. Sources cited for classification include the following: PMID 16415886 and 23351400. Classification of NM_017777.3(MKS1):c.1408-34_1408-6del29 is based on the following criteria: This is a well-established pathogenic variant in the literature that has been observed more frequently in patients with clinical diagnoses than in healthy populations. Please note: this variant was assessed in the context of healthy population screening. (less)
|
|
Pathogenic
(Apr 08, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Joubert syndrome 28
Affected status: unknown
Allele origin:
germline
|
Knight Diagnostic Laboratories, Oregon Health and Sciences University
Accession: SCV001448960.1
First in ClinVar: Dec 12, 2020 Last updated: Dec 12, 2020 |
Number of individuals with the variant: 1
Clinical Features:
Intellectual disability (present) , Global developmental delay (present) , Abnormality of the cerebral white matter (present) , Abnormality of the cerebral cortex (present) , Microcephaly … (more)
Intellectual disability (present) , Global developmental delay (present) , Abnormality of the cerebral white matter (present) , Abnormality of the cerebral cortex (present) , Microcephaly (present) , Absent speech (present) , Self-injurious behavior (present) , Repetitive compulsive behavior (present) , Feeding difficulties (present) , Abnormal facial shape (present) , Low-set ears (present) , Abnormality of head or neck (present) , Oral cleft (present) , Bruxism (present) , Abnormality of the optic nerve (present) , Corneal scarring (present) , Abnormal vascular morphology (present) , Macular hypoplasia (present) , Abnormality of skeletal morphology (present) , Inguinal hernia (present) , Joint hypermobility (present) , Cryptorchidism (present) , Intracranial hemorrhage (present) , Mitral valve prolapse (present) , Hypothyroidism (present) , Congenital diaphragmatic hernia (present) , Hernia (present) , Pulmonary hypoplasia (present) , Aplasia/Hypoplasia of the lungs (present) , Fatigue (present) , Abdominal symptom (present) , Intestinal malrotation (present) , Abnormal muscle tone (present) , Recurrent pneumonia (present) , Esotropia (present) , Hypopigmentation of the fundus (present) , Impaired continence (present) , Enuresis (present) , Polyhydramnios (present) , Webbed neck (present) , Abnormality of prenatal development or birth (present) , Functional abnormality of the bladder (present) , Abnormality of skin morphology (present) , Thick vermilion border (present) , Gingival overgrowth (present) , Gastroesophageal reflux (present) , Abnormality of the eyelid (present) , Ventriculomegaly (present) , Pectus excavatum (present) , Abnormal facial shape (present) , Dysphagia (present) , Laryngeal cleft (present) , Sleep disturbance (present) , Happy demeanor (present) , Abnormality of binocular vision (present) , Generalized muscle weakness (present) , Thick eyebrow (present) (less)
Sex: male
|
|
Pathogenic
(May 29, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Genetic Services Laboratory, University of Chicago
Accession: SCV002070502.1
First in ClinVar: Jan 29, 2022 Last updated: Jan 29, 2022 |
Comment:
DNA sequence analysis of the MKS1 gene demonstrated a 29 bp-deletion in intron 15, c.1408-34_1408-6del. This intronic change is a founder mutation in the Finnish … (more)
DNA sequence analysis of the MKS1 gene demonstrated a 29 bp-deletion in intron 15, c.1408-34_1408-6del. This intronic change is a founder mutation in the Finnish population and a known cause of Meckel-Gruber syndrome. It has been reported in the homozygous and compound heterozygous state in multiple affected individuals (PMIDs: 16415886, 17935508, 17397051). Functional studies in an affected individual's fibroblasts have demonstrated that this variant disrupts mRNA splicing leading to a premature stop codon and a truncated or absent protein (PMID: 16415886). (less)
|
|
Pathogenic
(May 03, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000330065.6
First in ClinVar: Dec 06, 2016 Last updated: Mar 04, 2023 |
Comment:
Described as a founder mutation in the Finnish population and many other European populations (Kyttala et al., 2006; Frank et al., 2007); Published functional studies … (more)
Described as a founder mutation in the Finnish population and many other European populations (Kyttala et al., 2006; Frank et al., 2007); Published functional studies demonstrate abnormal gene splicing (Kyttala et al., 2006); In silico analysis, which includes splice predictors and evolutionary conservation, supports a deleterious effect; This variant is associated with the following publications: (PMID: 17377820, 23351400, 17437276, 17935508, 16415886, 17397051, 27377014, 29096034) (less)
|
|
Pathogenic
(Feb 20, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Meckel syndrome, type 1
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV003845047.1
First in ClinVar: Mar 26, 2023 Last updated: Mar 26, 2023 |
Comment:
Variant summary: MKS1 c.1408-34_1408-6del29 alters a nucleotide located close to a canonical splice site and therefore could affect mRNA splicing, leading to a significantly altered … (more)
Variant summary: MKS1 c.1408-34_1408-6del29 alters a nucleotide located close to a canonical splice site and therefore could affect mRNA splicing, leading to a significantly altered protein sequence. Several computational tools predict a significant impact on normal splicing: Three predict the variant abolishes a 3 prime acceptor site. However, these predictions have yet to be confirmed by functional studies. The variant allele was found at a frequency of 0.0011 in 246468 control chromosomes. This frequency is not significantly higher than estimated for a pathogenic variant in MKS1 causing Meckel Syndrome Type 1, allowing no conclusion about variant significance. c.1408-34_1408-6del29 has been reported in the literature in individuals affected with Meckel Syndrome Type 1. These data indicate that the variant is likely to be associated with disease. Twelve clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation (pathogenic n=11, VUS n=1). Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
Pathogenic
(Jun 16, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV002024355.3
First in ClinVar: Nov 29, 2021 Last updated: Feb 04, 2024 |
|
|
Pathogenic
(Jan 24, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Familial aplasia of the vermis
Meckel-Gruber syndrome
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases.
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000219167.10
First in ClinVar: Mar 29, 2015 Last updated: Feb 28, 2024 |
Comment:
This sequence change falls in intron 15 of the MKS1 gene. It does not directly change the encoded amino acid sequence of the MKS1 protein. … (more)
This sequence change falls in intron 15 of the MKS1 gene. It does not directly change the encoded amino acid sequence of the MKS1 protein. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is present in population databases (rs749737706, gnomAD 0.7%), and has an allele count higher than expected for a pathogenic variant. This variant has been observed in individual(s) with Meckel-Gruber syndrome (PMID: 16415886, 17377820, 17397051, 17437276, 17935508). It is commonly reported in individuals of Finnish ancestry (PMID: 23351400). ClinVar contains an entry for this variant (Variation ID: 188400). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in skipping of exon 16 and introduces a new termination codon (PMID: 16415886). However the mRNA is not expected to undergo nonsense-mediated decay. For these reasons, this variant has been classified as Pathogenic. (less)
|
|
Pathogenic
(Feb 09, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
MKS1-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004105551.2
First in ClinVar: Nov 20, 2023 Last updated: Mar 16, 2024 |
Comment:
The MKS1 c.1408-34_1408-6del29 variant is predicted to result in an intronic deletion. This deletion has been shown to disrupt splicing of MKS1 and cause Meckel-Gruber … (more)
The MKS1 c.1408-34_1408-6del29 variant is predicted to result in an intronic deletion. This deletion has been shown to disrupt splicing of MKS1 and cause Meckel-Gruber syndrome in multiple unrelated individuals when found in the homozygous or compound heterozygous states (reported as IVS15-7_35del in Table 1, Kyttala et al. 2006. PubMed ID: 16415886; reported as c.1408-35_1408-7del29, Szymanska et al. 2012. PubMed ID: 23351400). This variant is reported in 0.70% of alleles in individuals of European (Finnish) descent in gnomAD. In ClinVar, this variant is reported as pathogenic (https://www.ncbi.nlm.nih.gov/clinvar/variation/188400/). This variant is interpreted as pathogenic. (less)
|
|
Pathogenic
(Jan 26, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV003547042.3
First in ClinVar: Feb 07, 2023 Last updated: May 01, 2024 |
Comment:
The c.1408-34_1408-6del29 alteration is located in intron 15 of the MKS1 gene. This alteration consists of a deletion of 29 nucleotides at nucleotide position c.1408-34 … (more)
The c.1408-34_1408-6del29 alteration is located in intron 15 of the MKS1 gene. This alteration consists of a deletion of 29 nucleotides at nucleotide position c.1408-34 to c.1408-6. This mutation has been identified in the homozygous state in multiple Meckel syndrome families and is considered a founder mutation in the Finnish population (Kyttälä, 2006). It has also been reported in several other individuals in the homozygous or compound heterozygous state with Meckel syndrome or a MKS1-related ciliopathy (Consugar, 2007; Szymanska, 2012; Bader, 2016). Analysis of fibroblasts from an individual homozygous for this mutation demonstrated aberrant splicing (Kyttälä, 2006). Based on the available evidence, this alteration is classified as pathogenic. (less)
|
|
Pathogenic
(Mar 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV000493247.28
First in ClinVar: Dec 06, 2016 Last updated: May 12, 2024 |
Comment:
MKS1: PM3:Very Strong, PM2, PP3, PS3:Supporting
Number of individuals with the variant: 3
|
|
Pathogenic
(Nov 01, 2007)
|
no assertion criteria provided
Method: literature only
|
MECKEL SYNDROME, TYPE 1
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000043096.2
First in ClinVar: Apr 04, 2013 Last updated: Feb 24, 2015 |
Comment on evidence:
In 3 Finnish families sharing the founder MKS1 haplotype and in 1 German patient with evidence of linkage of Meckel syndrome to 17q23 (MKS1; 249000), … (more)
In 3 Finnish families sharing the founder MKS1 haplotype and in 1 German patient with evidence of linkage of Meckel syndrome to 17q23 (MKS1; 249000), Kyttala et al. (2006) found that the MKS1 gene showed a 29-bp deletion in intron 15 as the cause of the anomaly. This deletion was located only 4 bp away from the splice acceptor site and probably interrupted the splice branching site. The same intronic deletion was found in 26 Finnish families with a common founder haplotype; all affected individuals were homozygous, and the parents heterozygous, for the deletion, which Kyttala et al. (2006) called the MKS1-Fin(major) mutation. This mutation was also found in an American family and in a family of mixed Swedish-Portuguese-Irish descent. Auber et al. (2007) identified the 29-bp deletion in intron 15 of the MKS1 gene in 8 of 20 unrelated fetuses diagnosed clinically with MKS. Six cases, consisting of 1 heterozygous and 5 homozygous mutations, had the campomelic variant of the disorder. The carrier frequency of this mutation in the German population was determined to be 1 in 260. (less)
|
|
Pathogenic
(Sep 16, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Meckel syndrome type 1
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV001455368.1
First in ClinVar: Jan 02, 2021 Last updated: Jan 02, 2021 |
|
|
pathogenic
(-)
|
no assertion criteria provided
Method: not provided
|
Meckel syndrome type1
Affected status: not provided
Allele origin:
unknown
|
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)
Accession: SCV000082438.1
First in ClinVar: Jul 24, 2013 Last updated: Jul 24, 2013
Comment:
FinDis database variant: This variant was not found or characterized by our laboratory, data were collected from public sources: see reference
|
Comment:
Converted during submission to Pathogenic.
|
|
Pathogenic
(Nov 29, 2017)
|
no assertion criteria provided
Method: clinical testing
|
Joubert syndrome 28
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000795925.2
First in ClinVar: Aug 05, 2018 Last updated: Dec 23, 2019 |
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
MKS1 mutations cause Joubert syndrome with agenesis of the corpus callosum. | Bader I | European journal of medical genetics | 2016 | PMID: 27377014 |
Founder mutations and genotype-phenotype correlations in Meckel-Gruber syndrome and associated ciliopathies. | Szymanska K | Cilia | 2012 | PMID: 23351400 |
A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome. | Auber B | Clinical genetics | 2007 | PMID: 17935508 |
Aberrant 5' splice sites in human disease genes: mutation pattern, nucleotide structure and comparison of computational tools that predict their utilization. | Buratti E | Nucleic acids research | 2007 | PMID: 17576681 |
Aberrant splicing is a common mutational mechanism in MKS1, a key player in Meckel-Gruber syndrome. | Frank V | Human mutation | 2007 | PMID: 17437276 |
Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online. | Khaddour R | Human mutation | 2007 | PMID: 17397051 |
Molecular diagnostics of Meckel-Gruber syndrome highlights phenotypic differences between MKS1 and MKS3. | Consugar MB | Human genetics | 2007 | PMID: 17377820 |
MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome. | Kyttälä M | Nature genetics | 2006 | PMID: 16415886 |
Statistical features of human exons and their flanking regions. | Zhang MQ | Human molecular genetics | 1998 | PMID: 9536098 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=MKS1 | - | - | - | - |
Text-mined citations for rs386834043 ...
HelpRecord last updated Jun 10, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
NCBI staff reviewed the sequence information reported in PubMed 16415886 Fig. S2 to determine the location of this allele on the current reference sequence.