NCBI CCDS banner
PubMed Entrez Gene BLAST OMIM
  

CCDS
Home
FTP
Process
Releases & Statistics

Collaborators
EBI
HGNC
MGI
NCBI

Contact Us
email CCDS

Genome Displays

Ensembl
NCBI
UCSC
VEGA

Related Resources
Gene
HomoloGene
MANE
RefSeq


Report for CCDS34486.3 (current version)

CCDS Status Species Chrom. Gene CCDS Release NCBI Annotation Release Ensembl Annotation Release Links
34486.3 Public Homo sapiens 6 COX7A2 24 110 108 CCDS HistoryNCBI Gene:1347Re-query CCDS DB by CCDS ID:34486.3Re-query CCDS DB by GeneID:1347See the combined annotation on chromosome 6 in Sequence Viewer

Public Note for CCDS 34486.1
The coding region has been updated to extend the N-terminus to one that is more supported by the available transcript data. The update adds a putative transmembrane domain to the protein. It should be noted that the start codon used in this update is restricted to higher primate species. This start codon has a weak Kozak signal, so it is possible that leaky scanning by ribosomes may occur some of the time, thus allowing the better conserved downstream start codon to be used, resulting in a protein that is 32 aa shorter at the N-terminus. No experimental evidence exists to show which start codon is used in vivo.

Public since: CCDS release 3, NCBI annotation release 36.2, Ensembl annotation release 41

Review status: Reviewed (by RefSeq, Havana and CCDS collaboration)


Attributes
CDS uses downstream AUG

Sequence IDs included in CCDS 34486.3

Original Current Source Nucleotide ID Protein ID MANE Status in CCDS Seq. Status Links
Original member Current member EBI ENST00000684430.2 ENSP00000506727.1 MANE Select Accepted alive Link to Ensembl Transcript Viewer:ENST00000684430.2Link to Ensembl Protein Viewer:ENSP00000506727.1Re-query CCDS DB by Nucleotide ID:ENST00000684430Re-query CCDS DB by Protein ID:ENSP00000506727
Original member Current member NCBI NM_001366292.3 NP_001353221.2 Accepted alive Link to Nucleotide Sequence:NM_001366292.3Link to Protein Sequence:NP_001353221.2Re-query CCDS DB by Nucleotide ID:NM_001366292Re-query CCDS DB by Protein ID:NP_001353221Link to BLAST:NP_001353221.2
Original member Current member NCBI NM_001366293.2 NP_001353222.1 MANE Select Accepted alive Link to Nucleotide Sequence:NM_001366293.2Link to Protein Sequence:NP_001353222.1Re-query CCDS DB by Nucleotide ID:NM_001366293Re-query CCDS DB by Protein ID:NP_001353222Link to BLAST:NP_001353222.1
Original member Current member NCBI NM_001865.6 NP_001856.3 Accepted alive Link to Nucleotide Sequence:NM_001865.6Link to Protein Sequence:NP_001856.3Re-query CCDS DB by Nucleotide ID:NM_001865Re-query CCDS DB by Protein ID:NP_001856Link to BLAST:NP_001856.3

RefSeq Length Related UniProtKB/SwissProt Length Identity Gaps Mismatches
NP_001353221.2 83 P14406 83 100% 0 0
NP_001353222.1 83 P14406 83 100% 0 0
NP_001856.3 83 P14406 83 100% 0 0

Chromosomal Locations for CCDS 34486.3

Assembly GRCh38.p14 (GCF_000001405.40)

On '-' strand of Chromosome 6 (NC_000006.12)
Genome Browser links: Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 6Link to Ensembl Genome Browser on chromosome 6See the combined annotation on chromosome 6 in Sequence Viewer

Chromosome Start Stop Links
6 75237930 75237988 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 6Link to Ensembl Genome Browser on chromosome 6
6 75240301 75240385 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 6Link to Ensembl Genome Browser on chromosome 6
6 75241176 75241265 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 6Link to Ensembl Genome Browser on chromosome 6
6 75243717 75243734 Link to NCBI NucleotideLink to UCSC Genome Browser on chromosome 6Link to Ensembl Genome Browser on chromosome 6

CCDS Sequence Data
Blue highlighting indicates alternating exons.
Red highlighting indicates amino acids encoded across a splice junction.
 
Mouse over the nucleotide or protein sequence below and click on the highlighted codon or residue to select the pair.

Nucleotide Sequence (252 nt):
ATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATT
TTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGG
TGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATA
TATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGA

Translation (83 aa):
MLRNLLALRQIGQRTISTASRRHFKNKVPEKQKLFQEDDEIPLYLKGGVADALLYRATMILTVGGTAYAI
YELAVASFPKKQE


Links Key
 Links to:   History report
  BLAST report
  Entrez Gene
  Nucleotide report
  Protein report
 Re-query CCDS DB by:   CCDS ID
  Gene ID
  Nucleotide ID
  Protein ID
 Genome Browser Links:   Ensembl Genome Browser
  NCBI Sequence Viewer
  UCSC Genome Browser
  VEGA Genome Browser

Disclaimer | Write to the Help Desk
NCBI | NLM | NIH