GEO Profiles Links for Nucleotide (Select 26336269) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 47

<< First< Prev

Page of 3

Next >Last >>

Select item 1299192861.

Sag - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5651, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129919286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 825807862.

Sag - Effects of high-fat maternal diet and transcription factor Cited2 deficiency on embryos

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS3724, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 82580786

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74766763.

Sag - MPSS transcriptome analysis project

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGTGTCATACCATA (ID_REF), GDS868, AK044214

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476676

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1186206864.

Sag - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5237, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118620686

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1233177865.

Sag - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5360, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123317786

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746138866.

Sag - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS3974, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74613886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1262310867.

Sag - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5436, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126231086

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226099868.

Sag - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5342, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 122609986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1326808869.

Sag - Diet-induced obesity model: white adipose tissue

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS6247, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132680886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6529155910.

Sag - Addictive drugs effect on brain striatum: time course

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1232031 (ID_REF), GDS3703, AK044214

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65291559

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7567794611.

Sag - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6481, 103520131 (ID_REF), GDS4002, AK044214, Sag (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75677946

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12982298612.

Sag - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5648, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129822986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11590898613.

Sag - Auditory fear conditioning effect on amygdala: time course

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5157, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115908986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13176608614.

Sag - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5821, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131766086

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12098748615.

Sag - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5293, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 120987486

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5464492216.

Sag - Skin carcinogenesis model

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL4234, 103520131 (ID_REF), GDS3334, AK044214

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54644922

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10500588617.

Sag - Colistin effect on the kidney

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS4834, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 105005886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13221418618.

Sag - High-fat diet effect on brown adipose tissue development

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS6000, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132214186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6226798619.

Sag - Claudin16 deficiency effect on kidneys

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS3612, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62267986

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12577728620.

Sag - Monoacylglycerol acyltransferase 1 deficiency effect on high-fat diet fed mice: liver

Annotation:: Sag, S-antigen, retina and pineal gland (arrestin)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1232031 (ID_REF), GDS5425, AK044214, SAG (ORF)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125777286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26336269) (47)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 47

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity