GEO Profile Links for Gene (Select 77833) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 971612871.

A930032L01Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS4495, AK020918

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97161287

GEO DataSets Gene Profile neighbors

Select item 716881372.

A930032L01Rik - Fasting effect on multiple tissues: time course

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL11012, 22637 (ID_REF), GDS3893, AK020918

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71688137

GEO DataSets Gene

Select item 499615713.

A930032L01Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226278_1 (ID_REF), GDS3148, AK020918

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49961571

GEO DataSets Gene Profile neighbors

Select item 215844054.

A930032L01Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34405 (ID_REF), GDS1882, AK020918

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584405

GEO DataSets Gene Profile neighbors

Select item 215844045.

A930032L01Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34404 (ID_REF), GDS1882, AK020918

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584404

GEO DataSets Gene Profile neighbors

Select item 625634506.

A930032L01Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl11406.1.1_274-S (ID_REF), GDS3621, A930032L01Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62563450

GEO DataSets Gene Profile neighbors

Select item 643620877.

A930032L01Rik - Hypertension model: aorta

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS3672, AK020918

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64362087

GEO DataSets Gene Profile neighbors

Select item 76715358.

A930032L01Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGACGAATTCCAAAT (ID_REF), GDS878, AK020918

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7671535

GEO DataSets Gene

Select item 75338359.

A930032L01Rik - MPSS transcriptome analysis project

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGACGAATTCCAAAT (ID_REF), GDS868, AK020918

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533835

GEO DataSets Gene

Select item 9787428710.

A930032L01Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS4527, AK020918

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97874287

GEO DataSets Gene Profile neighbors

Select item 6448088711.

A930032L01Rik - Hypertension model: kidney

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS3675, AK020918

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64480887

GEO DataSets Gene Profile neighbors

Select item 6444128712.

A930032L01Rik - Hypertension model: liver

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS3674, AK020918

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64441287

GEO DataSets Gene Profile neighbors

Select item 6440168713.

A930032L01Rik - Hypertension model: heart

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100108637_TGI_at (ID_REF), GDS3673, AK020918

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64401687

GEO DataSets Gene Profile neighbors

Select item 6196305014.

A930032L01Rik - Eset depletion effect on embryonic stem cell

Annotation:: A930032L01Rik, RIKEN cDNA A930032L01 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl11406.1.1_274-S (ID_REF), GDS3599, A930032L01Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61963050

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77833) (14)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity