GEO Profile Links for Gene (Select 71923) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1168

<< First< Prev

Page of 59

Next >Last >>

Select item 45080841.

Borcs6 - Glomerulonephropathy

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL254, 17951 (ID_REF), GDS580, AK009886

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4508084

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 719139052.

Borcs6 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2946608 (ID_REF), GDS3900, NM_028005

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71913905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299572663.

Borcs6 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2946608 (ID_REF), GDS5651, NM_028005, 2310047M10RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129957266

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 835605294.

Borcs6 - Non-obese diabetic (NOD) and disease-resistant NOD.NOR-Chr4 models: splenic B cells

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL1261, 1428723_at (ID_REF), GDS4340, 71923 (Gene ID), AK009886

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 83560529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553665885.

Borcs6 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL5759, XM_484040_at (ID_REF), GDS3385, XM_484040

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55366588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226700966.

Borcs6 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P518926 (ID_REF), GDS5343, NM_028005, A_51_P518926 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122670096

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1125161657.

Borcs6 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL4783, M200013660 (ID_REF), GDS2645, AK009886

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112516165

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677145058.

Borcs6 - IKKbeta deletion effect on neutrophils

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2946608 (ID_REF), GDS3776, NM_028005

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 67714505

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553685149.

Borcs6 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL5759, XM_908518_at (ID_REF), GDS3385, XM_908518

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55368514

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2394756010.

Borcs6 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430B)

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL340, 1428723_at (ID_REF), GDS2031, 71923 (Gene ID), AK009886

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 23947560

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12180356611.

Borcs6 - Lipopolysaccharide effect on fatty acid-loaded peritoneal macrophages in vitro

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2946608 (ID_REF), GDS5311, NM_028005, 2310047M10RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 121803566

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7316630512.

Borcs6 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2946608 (ID_REF), GDS3932, NM_028005

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73166305

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6162926613.

Borcs6 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2946608 (ID_REF), GDS3582, NM_028005, 2310047M10RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61629266

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4705262914.

Borcs6 - Matrix metalloproteinase mutant airway epithelial cells response to Pseudomonas aeruginosa infection: time course

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL1261, 1428723_at (ID_REF), GDS3040, 71923 (Gene ID), AK009886

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 47052629

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746955715.

2310047M10Rik - MPSS transcriptome analysis project

Annotation:: 2310047M10Rik, RIKEN cDNA 2310047M10 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAATGGTCACACACC (ID_REF), GDS868, AW494232

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7469557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 267519316.

Borcs6 - Spermatogenesis time course (MG-U74B)

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL82, 117281_at (ID_REF), GDS409, 71923 (Gene ID), AI844199

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2675193

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12267994217.

Borcs6 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P377126 (ID_REF), GDS5343, NM_028005, A_52_P377126 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122679942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10707262918.

Borcs6 - Stearoyl-CoA desaturase-1 deficiency effect on the skin

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL1261, 1428723_at (ID_REF), GDS4910, 71923 (Gene ID), AK009886

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 107072629

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7283729619.

Borcs6 - Spatial and temporal development of mammalian salivary glands

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P518926 (ID_REF), GDS3922, NM_028005, A_51_P518926 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72837296

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7281516620.

Borcs6 - Intestinal microbiota depletion effect on colon epithelial cells

Annotation:: Borcs6, BLOC-1 related complex subunit 6

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2946608 (ID_REF), GDS3921, NM_028005, 2310047M10RIK (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 72815166

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 59

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 71923) (1168)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1168

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity