GEO Profile Links for Gene (Select 234729) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1720

<< First< Prev

Page of 86

Next >Last >>

Select item 91927071.

Vac14 - Skeletal muscle response to voluntary running: time course

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL254, 15198 (ID_REF), GDS1019, AK011396

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9192707

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824575822.

Vac14 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2690506 (ID_REF), GDS3720, NM_146216

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82457582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922771623.

Vac14 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS4432, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92277162

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 370011624.

Vac14 - Asthma model: lungs

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS2647, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37001162

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 597396625.

Vac14 - Skeletal muscle response to myostatin inhibition

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS3526, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59739662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 217230626.

Vac14 - TGF-beta1 effect on renal mesangial cells

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS1892, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 21723062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 216765627.

Vac14 - Glucosamine and high glucose effect on renal mesangial cells

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS1891, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21676562

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1087105948.

Vac14 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10575476 (ID_REF), GDS4973, NM_146216, XM_006530919, AK140191, BC032215, BC052199, AK054468, chr8:110618638-110720402 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108710594

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 456000789.

Vac14 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4636, 17978 (ID_REF), GDS2976, NM_146216

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45600078

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7563082610.

Vac14 - High and Low Anxiety: multiple brain regions

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL7467, 10411 (ID_REF), GDS4001, AA008686

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75630826

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 13187879411.

Vac14 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10575476 (ID_REF), GDS5824, NM_146216, XM_006530919, AK140191, BC032215, BC052199, AK054468, chr8:110618638-110720402 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131878794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9967819412.

Vac14 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10575476 (ID_REF), GDS4578, NM_146216, XM_006530919, AK140191, BC032215, BC052199, AK054468, chr8:110618638-110720402 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99678194

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8667406213.

Vac14 - All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS4294, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 86674062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 450570714.

Vac14 - Glomerulonephropathy

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL254, 15198 (ID_REF), GDS580, AK011396

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 4505707

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6184766215.

Vac14 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS3596, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61847662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12683549416.

Vac14 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10575476 (ID_REF), GDS5456, NM_146216, XM_006530919, AK140191, BC032215, BC052199, AK054468, chr8:110618638-110720402 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126835494

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3131071117.

Vac14 - 2,3,7,8-tetrachlorodibenzo-p-dioxin effect on cultured embryonic teeth

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL81, 96023_at (ID_REF), GDS2383, 234729 (Gene ID), AI852472

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 31310711

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11250657718.

Vac14 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL3108, 16477 (ID_REF), GDS2574, AK011396

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112506577

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3257766219.

Vac14 - Limbal and central corneal epithelial basal cell comparison

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1416231_at (ID_REF), GDS2433, 234729 (Gene ID), NM_138588

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32577662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766002020.

Vac14 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Vac14, Vac14 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCACCTGGACCGCAGAGT (ID_REF), GDS878, NM_146216

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7660020

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 86

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 234729) (1720)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1720

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity