GEO Profile Links for Gene (Select 18588) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2308

<< First< Prev

Page of 116

Next >Last >>

Select item 1268819481.

Pde6g - Onecut2 deficiency effect on adult retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS5457, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126881948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268566062.

Pde6g - Onecut2 deficiency effect on adult retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS5457, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126856606

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1169011483.

Pde6g - Glycogen synthase kinase 3 inhibitor effect on retinal explant cultures from 129 and C57BL/6 strains

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS5188, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 116901148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1168758064.

Pde6g - Glycogen synthase kinase 3 inhibitor effect on retinal explant cultures from 129 and C57BL/6 strains

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS5188, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 116875806

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 982442485.

Pde6g - CD11c+ dendritic cell depletion effect on Herpes simplex virus-1 infection of cornea

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS4537, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 98244248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 982189066.

Pde6g - CD11c+ dendritic cell depletion effect on Herpes simplex virus-1 infection of cornea

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS4537, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 98218906

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 943373167.

Pde6g - rd1 model of retinal degeneration: time course

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL339, 1450453_a_at (ID_REF), GDS4510, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 94337316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 943280958.

Pde6g - rd1 model of retinal degeneration: time course

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL339, 1425100_a_at (ID_REF), GDS4510, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 94328095

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 637089489.

Pde6g - Diabetic retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS3657, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 63708948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6368360610.

Pde6g - Diabetic retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS3657, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 63683606

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6218134811.

Pde6g - Egr-1 deficiency effect on retina during eye development

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS3607, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 62181348

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6215600612.

Pde6g - Egr-1 deficiency effect on retina during eye development

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS3607, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 62156006

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4447020913.

Pde6g - Neural retina leucine zipper deficiency effect on retinas: time course

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL81, 97732_at (ID_REF), GDS2936, 18588 (Gene ID), Y00746

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 44470209

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3725340914.

Pde6g - Neurological aging models: retinas and hippocampi

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL81, 97732_at (ID_REF), GDS2654, 18588 (Gene ID), Y00746

DataSet type:: Expression profiling by array, count, 27 samples

ID:: 37253409

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3319011615.

Pde6g - Polyglutamine expansion disease model: retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL339, 1450453_a_at (ID_REF), GDS2464, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 33190116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3318089516.

Pde6g - Polyglutamine expansion disease model: retina

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL339, 1425100_a_at (ID_REF), GDS2464, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 33180895

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2105550917.

Pde6g - Retinitis pigmentosa 1 gene knockout effect on retinas: time course

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL81, 97732_at (ID_REF), GDS1845, 18588 (Gene ID), Y00746

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 21055509

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1805894818.

Pde6g - Transcription factor Nrl deficiency effect on photoreceptor development

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1450453_a_at (ID_REF), GDS1693, 18588 (Gene ID), NM_012065

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 18058948

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1803360619.

Pde6g - Transcription factor Nrl deficiency effect on photoreceptor development

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1261, 1425100_a_at (ID_REF), GDS1693, 18588 (Gene ID), BC014723

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 18033606

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747885620.

Pde6g - MPSS transcriptome analysis project

Annotation:: Pde6g, phosphodiesterase 6G, cGMP-specific, rod, gamma

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGCTATGTGAGCCC (ID_REF), GDS868, BC014723

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7478856

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 116

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 18588) (2308)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2308

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity