GEO Profile Links for Gene (Select 11670) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1726

<< First< Prev

Page of 87

Next >Last >>

Select item 1160088891.

Aldh3a1 - Lung response to highly virulent or low virulent influenza A H3N2 virus infection: time course

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1253178 (ID_REF), GDS5159, NM_007436

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 116008889

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 760845832.

Aldh3a1 - Transient hyperglycemia effect on transgenic diabetic aorta: time course

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS4016, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 76084583

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 626017833.

Aldh3a1 - Nrf2-deficient lung response to cigarette smoke: dose response and time course

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS3622, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, transformed count, 110 samples

ID:: 62601783

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 573526784.

Aldh3a1 - Kras G12D heterozygous mutation effect on somatic cell line (Sentrix MouseRef-8)

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL4865, scl41468.13.1_27-S (ID_REF), GDS3456, NM_007436

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 57352678

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 454822835.

Aldh3a1 - TGF-beta overexpression effect on the cornea

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS2974, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 45482283

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388116836.

Aldh3a1 - Pubertal mammary gland development

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL339, 1418752_at (ID_REF), GDS2721, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38811683

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 383603837.

Aldh3a1 - Transcription factor CHF1/Hey2 null smooth muscle cell response to platelet-derived growth factor: time course

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS2704, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 38360383

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 325801838.

Aldh3a1 - Limbal and central corneal epithelial basal cell comparison

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS2433, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32580183

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 205806159.

Aldh3a1 - Muscle cell survival mediated by transcriptional coactivator p300

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL81, 99548_at (ID_REF), GDS1821, 11670 (Gene ID), AF033034

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 20580615

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1719858310.

Aldh3a1 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS1647, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17198583

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1709378311.

Aldh3a1 - Myocilin over-secretion effect on the retina

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS1640, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 17093783

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 843211512.

Aldh3a1 - Hormone-induced adipogenesis suppressed by 2,3,7,8-tetrachlorodibenzo-p-dioxin and EGF

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL81, 99548_at (ID_REF), GDS951, 11670 (Gene ID), AF033034

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 8432115

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747893513.

Aldh3a1 - MPSS transcriptome analysis project

Annotation:: Aldh3a1, Aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCAGAGACATCAAGCG (ID_REF), GDS868, CX732145

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7478935

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 733961514.

Aldh3a1 - Corneal stromal cell differentiation

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL81, 99548_at (ID_REF), GDS857, 11670 (Gene ID), AF033034

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 7339615

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 733359615.

Aldh3a1 - Corneal stromal cell differentiation

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL81, 162331_f_at (ID_REF), GDS857, 11670 (Gene ID), AV089850

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 7333596

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12993869116.

Aldh3a1 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1253178 (ID_REF), GDS5651, NM_007436, ALDH3A1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129938691

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12243219117.

Aldh3a1 - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1253178 (ID_REF), GDS5336, NM_007436, ALDH3A1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122432191

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11432628318.

Aldh3a1 - FG-3019/gemcitabine combined-treatment effect on KPC model of pancreatic ductal adenocarcinoma

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL8321, 1418752_at (ID_REF), GDS4945, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 114326283

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8201208319.

Aldh3a1 - Oxidative-stress induced neurodegeneration in Harlequin mutant: olfactory epithelium

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS3365, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 82012083

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7259788320.

Aldh3a1 - Various central nervous system regions of adult inbred strain

Annotation:: Aldh3a1, aldehyde dehydrogenase family 3, subfamily A1

Organism:: Mus musculus

Reporter:: GPL1261, 1418752_at (ID_REF), GDS3917, 11670 (Gene ID), NM_007436

DataSet type:: Expression profiling by array, transformed count, 102 samples

ID:: 72597883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 87

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11670) (1726)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1726

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity