GEO Profile Links for Gene (Select 108950) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 209

<< First< Prev

Page of 11

Next >Last >>

Select item 1162788291.

1700049L16Rik - Small-molecule inhibition of BRDT effect on testis

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215184 (ID_REF), GDS5172, NR_003644, 1700049L16RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116278829

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1327036292.

1700049L16Rik - Diet-induced obesity model: white adipose tissue

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215184 (ID_REF), GDS6247, NR_003644, 1700049L16RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132703629

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1194022323.

1700049L16Rik - Chronic, low level drug exposure effect on obese liver

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495730 (ID_REF), GDS5258, NR_003644, A_51_P495730 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119402232

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1316395324.

1700049L16Rik - Normal liver developmental stages: embryonic and postnatal

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495730 (ID_REF), GDS5818, NR_003644, A_51_P495730 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131639532

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 46328355.

1700049L16Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m08571_a_at (ID_REF), GDS592, 1700049L16 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4632835

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1160450446.

1700049L16Rik - Bcl6 deficiency effect on regulatory T cell

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS5161, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116045044

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 847084447.

1700049L16Rik - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS4371, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84708444

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 715380328.

1700049L16Rik - Interstrain differences in the liver effects of trichloroethylene

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495730 (ID_REF), GDS3890, NR_003644, A_51_P495730 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71538032

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1226690329.

1700049L16Rik - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495730 (ID_REF), GDS5343, NR_003644, A_51_P495730 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122669032

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7509094410.

1700049L16Rik - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS3987, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75090944

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7283623211.

1700049L16Rik - Spatial and temporal development of mammalian salivary glands

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495730 (ID_REF), GDS3922, NR_003644, A_51_P495730 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72836232

GEO DataSets Gene Chromosome neighbors

Select item 10004564412.

1700049L16Rik - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS4588, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100045644

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 749268413.

1700049L16Rik - MPSS transcriptome analysis project

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATGTTTTGCTATGTGA (ID_REF), GDS868, BC048504

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7492684

GEO DataSets Gene Chromosome neighbors

Select item 12334052914.

1700049L16Rik - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215184 (ID_REF), GDS5360, NR_003644, 1700049L16RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123340529

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 5199315.

1700049L16Rik - Type 1 diabetes gene expression profiling

Annotation:: 1700049L16Rik, Hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL24, 24993 (ID_REF), GDS10, AA144577

DataSet type:: Expression profiling by array, count, 28 samples

ID:: 51993

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11434924416.

1700049L16Rik - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS4946, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114349244

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11858094417.

1700049L16Rik - Sarcolipin deficiency effect on heart atrium

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS5236, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118580944

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10915284418.

1700049L16Rik - Secreted frizzled-related protein 5 mutation effect on gonadal white adipose tissue

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS4988, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 109152844

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9965584419.

1700049L16Rik - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS4578, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99655844

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12865334420.

1700049L16Rik - Pregnancy effect on transplanted male pancreatic islets

Annotation:: 1700049L16Rik, hematological and neurological expressed 1-like pseudogene

Organism:: Mus musculus

Reporter:: GPL6246, 10369894 (ID_REF), GDS5618, NR_003644, chr10:71979882-71980694 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 128653344

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 11

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 108950) (209)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 209

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity